Sequence retrieval

Genome: Amycolatopsis mediterranei S699
Start position: 2390490
End position: 2390516
Length: 27

DNA sequence
>NC_018266, from 2390490 to 2390516 (27 bp); Amycolatopsis mediterranei S699 TCGGGCGTCTCGGGCGTCTCGGGCGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2390461-2391624	Sequence	AMES_2203 - peptidase S8 and S53, subtilisin, kexin, sedolisin