Sequence retrieval

Genome: Amycolatopsis mediterranei S699
Start position: 2249538
End position: 2249597
Length: 60

DNA sequence
>NC_018266, from 2249538 to 2249597 (60 bp); Amycolatopsis mediterranei S699 GTTCGGCCGCGGAAGGCTCGGCCGCAGGAGGTTCGGCTGCGGAAGGTTCGCCCGCGGGAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2248565-2250394	Sequence	AMES_2079 - hypothetical protein (Protein is coded in complementary strand; from 2250394 to 2248565)