Sequence retrieval

Genome: Amycolatopsis mediterranei S699
Start position: 1892034
End position: 1892057
Length: 24

DNA sequence
>NC_018266, from 1892034 to 1892057 (24 bp); Amycolatopsis mediterranei S699 GCGGCCGCGGCTGCTGCCGCGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1891977-1892612	Sequence	AMES_1741 - TetR family transcriptional regulator (Protein is coded in complementary strand; from 1892612 to 1891977)