Sequence retrieval

Genome: Amycolatopsis mediterranei S699
Start position: 1814144
End position: 1814206
Length: 63

DNA sequence
>NC_018266, from 1814144 to 1814206 (63 bp); Amycolatopsis mediterranei S699 TGTCGTCCGTTCCGGTGCGCGTGTCGTCCGCGCAGGTACGCGTGTCGTCCGTTCCGGTCACGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 1814202-1815026	Sequence	AMES_1679 - hypothetical protein (Protein is coded in complementary strand; from 1815026 to 1814202)