Sequence retrieval

Genome: Amycolatopsis mediterranei S699
Start position: 1727306
End position: 1727329
Length: 24

DNA sequence
>NC_018266, from 1727306 to 1727329 (24 bp); Amycolatopsis mediterranei S699 CCGGCGACGGCGCCCGCGCCGGTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1726007-1727443	Sequence	AMES_1593 - aminopeptidase (Protein is coded in complementary strand; from 1727443 to 1726007)