Sequence retrieval

Genome: Amycolatopsis mediterranei S699
Start position: 1714454
End position: 1714480
Length: 27

DNA sequence
>NC_018266, from 1714454 to 1714480 (27 bp); Amycolatopsis mediterranei S699 CGAGCATGCCGAGCTTGCCGAGGATGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1714048-1714812	Sequence	AMES_1583 frcA sugar ABC transporter ATPase (Protein is coded in complementary strand; from 1714812 to 1714048)