Sequence retrieval

Genome: Amycolatopsis mediterranei S699
Start position: 1694275
End position: 1694310
Length: 36

DNA sequence
>NC_018266, from 1694275 to 1694310 (36 bp); Amycolatopsis mediterranei S699 CCGGTTTGGGGGTGGGTTTGGGGGCCGGTTTGGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1694223-1695431	Sequence	AMES_1563 - chromosome segregation-related protein (Protein is coded in complementary strand; from 1695431 to 1694223)