Sequence retrieval

Genome: Amycolatopsis mediterranei S699
Start position: 1671864
End position: 1671887
Length: 24

DNA sequence
>NC_018266, from 1671864 to 1671887 (24 bp); Amycolatopsis mediterranei S699 GCCGCCGCCACCGCCGCTGCTGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1671796-1674177	Sequence	AMES_1541 - transcriptional accessory protein (Protein is coded in complementary strand; from 1674177 to 1671796)