Sequence retrieval

Genome: Amycolatopsis mediterranei S699
Start position: 1508396
End position: 1508419
Length: 24

DNA sequence
>NC_018266, from 1508396 to 1508419 (24 bp); Amycolatopsis mediterranei S699 GCCGGTGCCGGAGCCGCTGGCGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1508067-1509521	Sequence	AMES_1396 - carbohydrate-binding protein (Protein is coded in complementary strand; from 1509521 to 1508067)