Sequence retrieval

Genome: Amycolatopsis mediterranei S699
Start position: 1173198
End position: 1173227
Length: 30

DNA sequence
>NC_018266, from 1173198 to 1173227 (30 bp); Amycolatopsis mediterranei S699 GCTGCGGGTGCGGCGGCGGCTGCGGGTGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1173070-1174866	Sequence	AMES_1102 - ATP-dependent RNA helicase (Protein is coded in complementary strand; from 1174866 to 1173070)