Sequence retrieval

Genome: Amycolatopsis mediterranei S699
Start position: 1100840
End position: 1100863
Length: 24

DNA sequence
>NC_018266, from 1100840 to 1100863 (24 bp); Amycolatopsis mediterranei S699 GCCGTCGCCTTCGCTGTCGCCCTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1099944-1101548	Sequence	AMES_1032 - aminopeptidase (Protein is coded in complementary strand; from 1101548 to 1099944)