Sequence retrieval

Genome: Solibacillus silvestris StLB046
Start position: 79956
End position: 79982
Length: 27

DNA sequence
>NC_018065, from 79956 to 79982 (27 bp); Solibacillus silvestris StLB046 TTTTGCATCTTTTGCATCTTTTTCATC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 79698-80012	Sequence	SSIL_0061 - hypothetical protein (Protein is coded in complementary strand; from 80012 to 79698)