Sequence retrieval

Genome: Solibacillus silvestris StLB046
Start position: 438081
End position: 438107
Length: 27

DNA sequence
>NC_018065, from 438081 to 438107 (27 bp); Solibacillus silvestris StLB046 ATCAATATAATCAATATTAACAATATA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 437971-438621	Sequence	SSIL_0399 - response regulator of the LytR/AlgR family (Protein is coded in complementary strand; from 438621 to 437971)