Sequence retrieval

Genome: Solibacillus silvestris StLB046
Start position: 3013423
End position: 3013485
Length: 63

DNA sequence
>NC_018065, from 3013423 to 3013485 (63 bp); Solibacillus silvestris StLB046 GCCGCCTTTATTTTGTGTGTTACCACCTTTATTTGGCGTGTTACCGCCTCTATTTGGCGTGTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3011573-3013945	Sequence	SSIL_2952 infB translation initiation factor 2 (Protein is coded in complementary strand; from 3013945 to 3011573)