Sequence retrieval

Genome: Solibacillus silvestris StLB046
Start position: 2002885
End position: 2002911
Length: 27

DNA sequence
>NC_018065, from 2002885 to 2002911 (27 bp); Solibacillus silvestris StLB046 ACCACTTCGACCATTTCGACCACTTCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2001988-2002950	Sequence	SSIL_1922 - subtilisin-like serine protease (Protein is coded in complementary strand; from 2002950 to 2001988)