Sequence retrieval

Genome: Solibacillus silvestris StLB046
Start position: 1748753
End position: 1748779
Length: 27

DNA sequence
>NC_018065, from 1748753 to 1748779 (27 bp); Solibacillus silvestris StLB046 AAAACAAATAAAACAAATAAAGCAAAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1748276-1748896	Sequence	SSIL_1665 - heat shock protein (Protein is coded in complementary strand; from 1748896 to 1748276)