Sequence retrieval

Genome: Belliella baltica DSM 15883
Start position: 588007
End position: 588051
Length: 45

DNA sequence
>NC_018010, from 588007 to 588051 (45 bp); Belliella baltica DSM 15883 GACCTTGACCTGGTCTTCCTTGACCTGGTCTTCCTTGTCCTGGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 586086-589064	Sequence	Belba_0561 - translation initiation factor 2 (bIF-2) (Protein is coded in complementary strand; from 589064 to 586086)