Sequence retrieval

Genome: Belliella baltica DSM 15883
Start position: 3690825
End position: 3690860
Length: 36

DNA sequence
>NC_018010, from 3690825 to 3690860 (36 bp); Belliella baltica DSM 15883 ACTCCTTCTGACTTTCCTTCTGACATTCCTTCTGAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3690801-3695891	Sequence	Belba_3423 - hypothetical protein (Protein is coded in complementary strand; from 3695891 to 3690801)