Sequence retrieval

Genome: Belliella baltica DSM 15883
Start position: 2640374
End position: 2640409
Length: 36

DNA sequence
>NC_018010, from 2640374 to 2640409 (36 bp); Belliella baltica DSM 15883 AACTTTTCAATTAGTTTTTCAATTAGTTTTTCAATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 2640397-2641128	Sequence	Belba_2470 - hypothetical protein (Protein is coded in complementary strand; from 2641128 to 2640397)