Sequence retrieval

Genome: Belliella baltica DSM 15883
Start position: 3283395
End position: 3283424
Length: 30

DNA sequence
>NC_018010, from 3283395 to 3283424 (30 bp); Belliella baltica DSM 15883 TCATTTTTAATCATTTCTGATCATTATCAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 3281718-3283409	Sequence	Belba_3056 - outer membrane protein/peptidoglycan-associated (lipo)protein (Protein is coded in complementary strand; from 3283409 to 3281718)