Sequence retrieval

Genome: Belliella baltica DSM 15883
Start position: 2711097
End position: 2711126
Length: 30

DNA sequence
>NC_018010, from 2711097 to 2711126 (30 bp); Belliella baltica DSM 15883 AACTAAAGAAAAATAATGAAAAACAAAGAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2710298-2711167	Sequence	Belba_2535 - hypothetical protein (Protein is coded in complementary strand; from 2711167 to 2710298)