Sequence retrieval

Genome: Belliella baltica DSM 15883
Start position: 504676
End position: 504702
Length: 27

DNA sequence
>NC_018010, from 504676 to 504702 (27 bp); Belliella baltica DSM 15883 TGACCTCCACGACCTCCATCACCTCCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 503824-504816	Sequence	Belba_0475 - Obg family GTPase CgtA (Protein is coded in complementary strand; from 504816 to 503824)