Sequence retrieval

Genome: Belliella baltica DSM 15883
Start position: 807162
End position: 807186
Length: 25

DNA sequence
>NC_018010, from 807162 to 807186 (25 bp); Belliella baltica DSM 15883 TAATCTGATCTAATAAAATCTCATC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 806834-808558	Sequence	Belba_0765 - exonuclease RecJ (Protein is coded in complementary strand; from 808558 to 806834)