Sequence retrieval

Genome: Belliella baltica DSM 15883
Start position: 4057809
End position: 4057833
Length: 25

DNA sequence
>NC_018010, from 4057809 to 4057833 (25 bp); Belliella baltica DSM 15883 ATTTTCTTTTATTTAATATTAATTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 4056393-4057811	Sequence	Belba_3767 - cytochrome c oxidase accessory protein FixG (Protein is coded in complementary strand; from 4057811 to 4056393)
ORF... 4057828-4058745	Sequence	Belba_3768 - cytochrome c, mono- and diheme variants family (Protein is coded in complementary strand; from 4058745 to 4057828)