Sequence retrieval

Genome: Belliella baltica DSM 15883
Start position: 2474295
End position: 2474319
Length: 25

DNA sequence
>NC_018010, from 2474295 to 2474319 (25 bp); Belliella baltica DSM 15883 ATAATACAATTTAATATAAAATATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 2474306-2474437	Sequence	Belba_2315 - hypothetical protein (Protein is coded in complementary strand; from 2474437 to 2474306)