Sequence retrieval

Genome: Belliella baltica DSM 15883
Start position: 4095508
End position: 4095531
Length: 24

DNA sequence
>NC_018010, from 4095508 to 4095531 (24 bp); Belliella baltica DSM 15883 TCATGATCGTGATCATGGTCATGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4093675-4095564	Sequence	Belba_3790 - heme/copper-type cytochrome/quinol oxidase, subunit 1 (Protein is coded in complementary strand; from 4095564 to 4093675)