Sequence retrieval

Genome: Belliella baltica DSM 15883
Start position: 2600444
End position: 2600467
Length: 24

DNA sequence
>NC_018010, from 2600444 to 2600467 (24 bp); Belliella baltica DSM 15883 CAGGTGCAGGCGCAGCTGCAGGTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2600149-2600619	Sequence	Belba_2431 - acetyl-CoA carboxylase, biotin carboxyl carrier protein (Protein is coded in complementary strand; from 2600619 to 2600149)