Sequence retrieval

Genome: Belliella baltica DSM 15883
Start position: 1647201
End position: 1647224
Length: 24

DNA sequence
>NC_018010, from 1647201 to 1647224 (24 bp); Belliella baltica DSM 15883 TTCCAACCTTCCAATCTTCCAACT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1647143-1647265	Sequence	Belba_1554 - hypothetical protein (Protein is coded in complementary strand; from 1647265 to 1647143)