Sequence retrieval

Genome: Belliella baltica DSM 15883
Start position: 1489910
End position: 1489933
Length: 24

DNA sequence
>NC_018010, from 1489910 to 1489933 (24 bp); Belliella baltica DSM 15883 CAACTTTTCAATTTTTCAACTTAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 1489934-1491142	Sequence	Belba_1398 - cyanate permease (Protein is coded in complementary strand; from 1491142 to 1489934)