Sequence retrieval

Genome: Belliella baltica DSM 15883
Start position: 1473660
End position: 1473683
Length: 24

DNA sequence
>NC_018010, from 1473660 to 1473683 (24 bp); Belliella baltica DSM 15883 CAACTTCTACTTCACCTTCAACTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1472771-1474195	Sequence	Belba_1387 - NAD-dependent aldehyde dehydrogenase (Protein is coded in complementary strand; from 1474195 to 1472771)