Sequence retrieval

Genome: Enterococcus faecium DO
Start position: 919848
End position: 919872
Length: 25

DNA sequence
>NC_017960, from 919848 to 919872 (25 bp); Enterococcus faecium DO GTTTTGTTCTGTATTGTTTGCTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 919682-920152	Sequence	HMPREF0351_10944 gtrA teichoic acid glycosylation protein GtrA