Sequence retrieval

Genome: Enterococcus faecium DO
Start position: 841745
End position: 841768
Length: 24

DNA sequence
>NC_017960, from 841745 to 841768 (24 bp); Enterococcus faecium DO CAACAACCACAACAACTACAACAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 840617-841777	Sequence	HMPREF0351_10859 cps bacteriophage major capsid protein B