Sequence retrieval

Genome: Enterococcus faecium DO
Start position: 834269
End position: 834301
Length: 33

DNA sequence
>NC_017960, from 834269 to 834301 (33 bp); Enterococcus faecium DO TTTGGCGGTTTTTTGGCGGAATGATGGCGGTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 833856-834269	Sequence	HMPREF0351_10848 arpU ArpU family phage transcriptional regulator