Sequence retrieval

Genome: Enterococcus faecium DO
Start position: 302732
End position: 302756
Length: 25

DNA sequence
>NC_017960, from 302732 to 302756 (25 bp); Enterococcus faecium DO TTTTTGTTTTTTTTCATTTTTTTCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 301112-302749	Sequence	HMPREF0351_10320 - hypothetical protein (Protein is coded in complementary strand; from 302749 to 301112)
ORF. 302715-303236	Sequence	HMPREF0351_10321 - hypothetical protein