Sequence retrieval

Genome: Enterococcus faecium DO
Start position: 2522278
End position: 2522301
Length: 24

DNA sequence
>NC_017960, from 2522278 to 2522301 (24 bp); Enterococcus faecium DO GCCGCCACCGCCACCGCCGCCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2520662-2522773	Sequence	HMPREF0351_12545 ftsH M41 family endopeptidase FtsH (Protein is coded in complementary strand; from 2522773 to 2520662)