Sequence retrieval

Genome: Enterococcus faecium DO
Start position: 2222751
End position: 2222777
Length: 27

DNA sequence
>NC_017960, from 2222751 to 2222777 (27 bp); Enterococcus faecium DO CTTTTTCGTTTTTTTCGTCTTTTTCCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2220361-2222808	Sequence	HMPREF0351_12274 ftsK FtsK/SpoIIIE family DNA translocase (Protein is coded in complementary strand; from 2222808 to 2220361)