Sequence retrieval

Genome: Enterococcus faecium DO
Start position: 2037028
End position: 2037051
Length: 24

DNA sequence
>NC_017960, from 2037028 to 2037051 (24 bp); Enterococcus faecium DO TTTGTTTTTCTTTTTGTTTTTGAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2036601-2037185	Sequence	HMPREF0351_12093 ntpE proton (H+) or sodium (Na+) translocating V-type ATPase (V-ATPase), subunit E (Protein is coded in complementary strand; from 2037185 to 2036601)