Sequence retrieval

Genome: Enterococcus faecium DO
Start position: 2021372
End position: 2021395
Length: 24

DNA sequence
>NC_017960, from 2021372 to 2021395 (24 bp); Enterococcus faecium DO TCTTCATCTTCATCATCATCGTCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2021207-2021827	Sequence	HMPREF0351_12075 rpoE2 DNA-directed RNA polymerase subunit delta (Protein is coded in complementary strand; from 2021827 to 2021207)