Sequence retrieval

Genome: Enterococcus faecium DO
Start position: 2020451
End position: 2020480
Length: 30

DNA sequence
>NC_017960, from 2020451 to 2020480 (30 bp); Enterococcus faecium DO TAAGTTTTCTTTAGTTTTTTTAAATTTTCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2019596-2020495	Sequence	HMPREF0351_12073 - hypothetical protein (Protein is coded in complementary strand; from 2020495 to 2019596)