Sequence retrieval

Genome: Enterococcus faecium DO
Start position: 1870795
End position: 1870818
Length: 24

DNA sequence
>NC_017960, from 1870795 to 1870818 (24 bp); Enterococcus faecium DO ATTCTTTGATTCTTGGATTTTTTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1870266-1870838	Sequence	HMPREF0351_11910 - RNA methyltransferase (Protein is coded in complementary strand; from 1870838 to 1870266)