Sequence retrieval

Genome: Enterococcus faecium DO
Start position: 1807684
End position: 1807710
Length: 27

DNA sequence
>NC_017960, from 1807684 to 1807710 (27 bp); Enterococcus faecium DO TTTTTTCTTTTTCTTCTTATTTTTCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1807676-1809094	Sequence	HMPREF0351_11840 ffh Sec family Type I general secretory pathway protein signal recognition particle protein (Protein is coded in complementary strand; from 1809094 to 1807676)