Sequence retrieval

Genome: Enterococcus faecium DO
Start position: 1786798
End position: 1786830
Length: 33

DNA sequence
>NC_017960, from 1786798 to 1786830 (33 bp); Enterococcus faecium DO TTTTTGATACCTCTTTGATACCTCTTTGAAACC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1786768-1788615	Sequence	HMPREF0351_11816 - metal-dependent phosphoesterase (Protein is coded in complementary strand; from 1788615 to 1786768)