Sequence retrieval

Genome: Enterococcus faecium DO
Start position: 1708400
End position: 1708424
Length: 25

DNA sequence
>NC_017960, from 1708400 to 1708424 (25 bp); Enterococcus faecium DO CTTTTCTTTATTTTTATTTTGTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1708392-1708535	Sequence	HMPREF0351_11732 - hypothetical protein (Protein is coded in complementary strand; from 1708535 to 1708392)