Sequence retrieval

Genome: Enterococcus faecium DO
Start position: 1630248
End position: 1630271
Length: 24

DNA sequence
>NC_017960, from 1630248 to 1630271 (24 bp); Enterococcus faecium DO ATCTGCTTCTGCATTTGCTTCTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1629910-1631739	Sequence	HMPREF0351_11651 dnaK chaperone DnaK (Protein is coded in complementary strand; from 1631739 to 1629910)