Sequence retrieval

Genome: Enterococcus faecium DO
Start position: 1529118
End position: 1529153
Length: 36

DNA sequence
>NC_017960, from 1529118 to 1529153 (36 bp); Enterococcus faecium DO ATTGTTTTCTTTATTATTCTCTTTATTATTTTCTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1529116-1529607	Sequence	HMPREF0351_11558 nrdR NrdR family transcriptional regulator (Protein is coded in complementary strand; from 1529607 to 1529116)