Sequence retrieval

Genome: Enterococcus faecium DO
Start position: 1467945
End position: 1467974
Length: 30

DNA sequence
>NC_017960, from 1467945 to 1467974 (30 bp); Enterococcus faecium DO TTATTGTTATTATTTTTGTTATTGTTATTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1467075-1467977	Sequence	HMPREF0351_11483 gls33 general stress protein Gls33 (Protein is coded in complementary strand; from 1467977 to 1467075)