Sequence retrieval

Genome: Enterococcus faecium DO
Start position: 104242
End position: 104266
Length: 25

DNA sequence
>NC_017960, from 104242 to 104266 (25 bp); Enterococcus faecium DO TTTTTTTCTTTTTTGGTTTTTCTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 104220-104672	Sequence	HMPREF0351_10106 - hypothetical protein (Protein is coded in complementary strand; from 104672 to 104220)