Sequence retrieval

Genome: Modestobacter marinus
Start position: 3852362
End position: 3852397
Length: 36

DNA sequence
>NC_017955, from 3852362 to 3852397 (36 bp); Modestobacter marinus CGGCGAGCTCGGCGAGCTCGGCGAGCTCGGCGAGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3852121-3852486	Sequence	MODMU_3882 - XRE family transcriptional regulator (Protein is coded in complementary strand; from 3852486 to 3852121)