Sequence retrieval

Genome: Cronobacter sakazakii ES15
Start position: 702435
End position: 702459
Length: 25

DNA sequence
>NC_017933, from 702435 to 702459 (25 bp); Cronobacter sakazakii ES15 GCGGCGCGTCGAGGCGCAGCGCGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 702041-704299	Sequence	ES15_0665 - hypothetical protein (Protein is coded in complementary strand; from 704299 to 702041)