Sequence retrieval

Genome: Cronobacter sakazakii ES15
Start position: 4111967
End position: 4111990
Length: 24

DNA sequence
>NC_017933, from 4111967 to 4111990 (24 bp); Cronobacter sakazakii ES15 GAAGAAGTAGAAAAAGAAGAAGAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4110783-4112045	Sequence	ES15_3766 lacY3 galactoside permease (Protein is coded in complementary strand; from 4112045 to 4110783)